burgesstacresha burgesstacresha
  • 01-05-2018
  • English
contestada

I wanted to add by the way that i went to visit the washington monument in washington , D.C. over the weekend. Correct comma usage

Respuesta :

faithself12 faithself12
  • 01-05-2018
I wanted to add by the way that I went to visit the Washington Monument, in Washington D.C. over the weekend.
Answer Link
12rdominguez 12rdominguez
  • 03-09-2020

Answer: I wanted to add, by the way, that I went to visit the Washington Monument in Washington, D.C. over the weekend.

Explanation:

Answer Link

Otras preguntas

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
i need help with #3
2ln(5x)=8 solve for x
Please answer theses division problems!! 9 divided by 3/7
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
I want to work with LDAP. what is LDAP?
how do you say theatre in Spanish