deee9716 deee9716
  • 02-03-2018
  • Social Studies
contestada

Working effectively with others requires that individuals:

Respuesta :

andriansp andriansp
  • 11-03-2018
It require each individuals to draw on subtle aspects of themselves and appeal to those aspects in others..
By doing this, each individuals could combined all of their personal strength to the group and opened themselves so their team members could cover the weaknesses that they have. 
Answer Link

Otras preguntas

In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Fossils are most commonly found in which type of rock?
a summary about concussions
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
A vehicle is only 15% efficient. What happened to the other 85%?
Please help me with this two step math problem! THANK YOU !!!!!!!!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?