jocekyn169 jocekyn169

01-12-2017
Mathematics

contestada

What is the probability of someone ordering nachos chicken strips and cookies

Respuesta :

sathomas sathomas

01-12-2017

100% is the probability

Answer Link

Аноним Аноним

01-12-2017

Zero if he is in a furniture shop!

Answer Link

Otras preguntas

how is an error within an EMR corrected

PLEASE HELP ME!! What was the name of the system developed by FDR Roosevelt during the Great Depression to aid lower income people? B) Medicare C) M

2x + 3y = 144x + 6y = 28 Which statement about the pair of equations is true?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which of the following do scientists think will probably cause Earth's next ice age?

which goal stated in the preamble to the u.s. constitution requires a strong army

What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?

Which of the following is a run-on sentence?

Which of the following can be a cause of social change?

Which american colony was established in the 1660s as a haven for quakers?