jacalocs2264 jacalocs2264

01-09-2017
Biology

contestada

What portion of the pituitary gland is controlled by nervous impulses?

Respuesta :

marinaxxxtheede marinaxxxtheede

01-09-2017

the nervous system??

Answer Link

Otras preguntas

what does the constitution state about the interaction of the judicial branch and new laws

the expression 3.25b + 2h gives the cost of b burgers and h hot dogs what is the cost of 4 burgers and 6 hot dogs

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m

Through what system is glucose delievered to cells for cellular respiration

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Express the area of a rectangle with length 7ab and width 2a as a monomial.

If you’re over 21 you could be arrested for a DUI if your PAC is at or over ? Thanks

Find the area of a kite with diagonals 10 & 5

Can someone please help me understand this?!?! i dont know what to even do. Write an equation for the line parallel to the given line that contains C. C(4,7); y