lilcupcakemacy lilcupcakemacy
  • 04-08-2017
  • Chemistry
contestada

helium is the lightest monatomic element is this a chemical property

Respuesta :

Khalie02 Khalie02
  • 05-08-2017
No it wouldn't because of it was chemical, it would change into something completely different, for this reason, it would be physical property
Answer Link

Otras preguntas

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
why did Mr Collins come to the Bennet family looking for a wife?
Tu as quels cours le jeudi matin?
Do you think then solid can undergo convection
round 7,782 to the nearest hundred
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5