jadawilliamz198 jadawilliamz198

05-05-2017
Mathematics

contestada

You have 42 plants.You want to split them equally between 4 sections of your garden.You use as many as you can in each section.How many plants do you have left?

Respuesta :

cutelion918 cutelion918

05-05-2017

You simply divide
42 divided by 4= 1 1/2 but that's not possible and when you first divide, the remainder was 2 so 2 plants is your answer

Answer Link

Otras preguntas

Pls answer this question

Toco el piano _______________ hace dos meses. desde se les por

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

which statement is true for a career as a graphic designer?

which nutrition provides the highest number of calories per grama)fatb)proteinc) carbohydrated)suger

A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk

Less developed countries (LDCs) have a/an____ population growth. A.average B. negative C. positive D. unchanged

A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9

Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes