01-03-2017
Biology

contestada

Proteins are made from nucleic acids such as glycine.
A. True
B. False

Respuesta :

Heydoyoulikebands Heydoyoulikebands

01-03-2017

False, proteins are made up of amino acids.

Answer Link

Otras preguntas

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

When reading for subject content, prereading activities are not important. Please select the best answer from the choices provided True or False

If an employee gets potentially infectious material splashed in his eye, what should he do?

Carl earned $6.20 per hour and worked 6 1/2 hours per day. What is the best estimate of his earning for a five-day work week?

Exponential Equation WITHOUT CALCULATOR

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Name a few important body functions that your nervous system controls on its own without you having to think about it much?

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

Why is plagiarism a violation of ethics? a. it makes psychology researchers look bad. b. it violates an apa standard. c. it is akin to lying. d. it violates a b

One of the benefits that the gi bill of rights offered to returning veterans was