beckyodell2001 beckyodell2001

03-02-2015
Mathematics

contestada

where would the square root of 130 be located on the number line

Respuesta :

VzDeath VzDeath

03-02-2015

[tex] \sqrt{130}=\boxed{11.40175425099138}\ it\ would\ be\ located\ in\ between\ 11\ and\ 12. [/tex]

Answer Link

Otras preguntas

what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?

The word biology means the study of _____. plants animals organisms life

Which English reformer called for change in the church during the 1300's

an integer is one more than four times another. if the product of two integers is 39, then find the integers

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

What is true about the energy involved in a chemical reaction? (3 points) The amount of energy is constant, but it is converted from one form to another. T

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What role does the House of Representative have in the impeachment process?

Two boys on bicycles start cycling from the same place at the same time. one cyclist travels 15 miles per hour, the other travels 12 miles per hour, if they tra

While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi