SapphireWolf111
SapphireWolf111 SapphireWolf111
  • 03-01-2022
  • Biology
contestada

Please help me this is my last question.
You guys can do 1 sentence.

Thank you :)​

Please help me this is my last questionYou guys can do 1 sentenceThank you class=

Respuesta :

ashish4112119
ashish4112119 ashish4112119
  • 12-01-2022

if the shoreline is eroding due to pollution or construction the weather becomes more dangerous because there are less plant & wildlife to slow ot down

Answer Link

Otras preguntas

Round 46.895 to the nearest tenth
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Please help with Algebra 1
in what area of Europe were the majority of warsaw pact countries
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Which body tissue or organ contains the most mitochondria?