bailey0967 bailey0967
  • 01-10-2021
  • Health
contestada

10. Which of the following is NOT a rules violation in soccer? (1 point)
O Chest trap
O Tripping
O Handball
O Obstruction

Respuesta :

inniter
inniter inniter
  • 01-10-2021
answer: a) Chest trap
Answer Link
ddddelgadillo2k04 ddddelgadillo2k04
  • 01-10-2021
The answer is chest trap
Answer Link

Otras preguntas

This natural landmark was created by the natural forces of erosion. What is its correct name and location?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why was wilson not able to finish his speaking tour
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
round 7,782 to the nearest hundred
Did feudalism create a stable form of government?
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place