video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

i hate this brainly thing so so so much
I need help with project
i hate this brainly thing so so so much
the answer is 20/13 you can simplify the answer.
Jocelyn complied data on the number of hours students work per week the summer after senior year. The minimum number of hours is the distribution was 23. The ra
Can someone help me? Im really bad at English ​
In this type of governance the power is in the hands of one person​
According to the Law of Conservation of Matter, if I have an Oreo cookie that weighs 20 grams and I crush it into crumbs for a recipe, how much do the crumbs we
A bag contains the following marbles: 8 black marbles, 12 blue marbles, 18 brown marbles, and 6 green marbles. What is the ratio of brown marbles to blue marble
What is the largest known number called?