mabeldeleon555 mabeldeleon555

04-03-2021
Mathematics

contestada

What is the best estimate of the total number of crabs found in the Mid-Atlantic region? Help please

What is the best estimate of the total number of crabs found in the MidAtlantic region Help please class=

Respuesta :

4804228113 4804228113

11-03-2021

Answer:

100

Step-by-step explanation:

because i got it right

Answer Link

Otras preguntas

What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67

Which type of oscillation would most likely produce an electromagnetic wave?

When did the eastern part of the Roman Empire fall?

Under the articles of confederation, political power and authority ultimately rested with the ________.

Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i

I=$310 P==$1,000 t=5 years

A carpenter is making a blanket chest based on an antique chest. Both chests have the shape of a rectangular prism. The length width and height of the new chest

How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat