emiliemccoig emiliemccoig

02-03-2021
Spanish

contestada

- Los padres de Viviana
____________mucho

A. Canta
B. Cantan

Respuesta :

carmelman carmelman

02-03-2021

The awnser is b hope that helps

Answer Link

sambravo45 sambravo45

02-03-2021

B Cantan is the correct answer for this (: i need 20 words lol

Answer Link

Otras preguntas

Help me please im about to give up

For some time, the English had little interest in colonizing for what two reasons?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month

the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

Which aspect of communist economies kept them from matching the production efficiency and quality of free market economies

show work and factor ?

One number is 6 more than twice the other number. if the sum of the two numbers is 36, find the two numbers.