deb80
deb80 deb80
  • 01-01-2021
  • Mathematics
contestada

find the value of x​

find the value of x class=

Respuesta :

MoatazMahmoud817
MoatazMahmoud817 MoatazMahmoud817
  • 01-01-2021

Answer:

x= 64

Step-by-step explanation:

by Z rule

x= 180-116 = 64

Ver imagen MoatazMahmoud817
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help me with this
Do you think there are benefits to teaching prisoners about philosophy?
What’s the answer to #12? and why
What is the domain of the this function?
-( x + 4 ) = 2x + 35
If o- can give to every other blood type, why cant it recieve other blood types
The actions of the pueblo indians at santa fe in 1680 can best be described as:
In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co
Name the five transport mechanisms of the cell: