MyaRod749 MyaRod749

03-06-2020
English

contestada

which text structure does the author use in the section "A Daring Plan?"

Respuesta :

sallyyyy78ee sallyyyy78ee

04-06-2020

I agree with the following comment ^^^

Answer Link

Otras preguntas

What is the land like along the coast in Maine? rocky and rugged sandy and hilly low and flat mountainous

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Janie spends 10 hours per week making flower arrangements. Yesterday she was offered an after-school job by the pet store in the mall, which she often visits to

please helpppppppppppppppppppp meeeeeeeeeeeeeeeeeeeeee

HELP how to do this I will give Brainliest

help me, its pretty easy LOL Imagine if you created a character of your choice. You could customize it as you wish. Then answer these questions. What would be y

Which list describes the path traveled by sperm from inside the body to the external environment? vas deferens Right arrow. epididymis Right arrow. urethra Righ

What are the first words of the Constitution? We hold these truths We the people Four score and seven years ago All mean are created equial

Question 19 1 pts Which element of fiction is used to resolve a story's conflict? A. a sequence of events B. mood and setting C. the exposition D. characterizat

Which action does not take place in Part 1? O Cole wields a spear at the Spirit Bear. Cole attempts to escape the island. O Cole burns down the shelter. O Cole