juliana0623 juliana0623
  • 01-01-2020
  • History
contestada

Who is the president of the United States

Respuesta :

lauren6751
lauren6751 lauren6751
  • 01-01-2020
The current president is Donald Trump. He is the 45th president and started in the year of 2017. He is 73 years old and is of the Republican Party.
Answer Link

Otras preguntas

Define erlang, the measurement unit used in telecommunications traffic engineering. Discuss traffic engineering approaches of traditional voice phone networks a
2. In the beginning what did the NFL do regarding Dr. Amalu's findings
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Assume that Joyce's physiological and safety needs are met, but her other needs are not met. According to Maslow's need hierarchy theory, Joyce is most likely t
To The Nearest 10th, Find the volume of a sphere with a diameter of 10 cm. Use 3.14 for pie
What belief did reforms hold about insanity
Which step in project management requires project managers to consider the types of records and reports they and their clients will require at the completion of
Question 14 (5 points) The US built the Panama Canal before Panama gained its independence from Colombia. True False
Strolling through the city park late at night, we saw several young couples walking their dogs, as well as a whole bunch of squirrels scurrying about seeking nu
just doing this for fun 50 points. 12 * 12