alondrams132 alondrams132
  • 01-06-2016
  • Mathematics
contestada

John made 2 quarts of juice for a school party. He said that he made 2/4 cups of juice. Explain John's mistake.

Respuesta :

assassin4234
assassin4234 assassin4234
  • 01-06-2016
The conversion from quarts to cups is:
1 cup = 1/4 quart
John made the mistake of using the conversion the other way around
Therefore, he thought that 1 quart was 1/4 cups instead.

This would result in John getting 2/4 cups rather than 8 cups, which should be the accepted value

Hope this helped ^_^
Answer Link

Otras preguntas

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
a antonym for biosphere
Do you think then solid can undergo convection
what is the most common type of vegetation throughout Latin America
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
what is 0.00001267 is scientific notation
four yardequal Blank feet
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes