Seudónimo Seudónimo
  • 02-08-2019
  • Mathematics
contestada

CAN? please help
Julie spent 6 hours on the phone in 2 days. How many hours will she spend on the phone in a week?

Respuesta :

catchonyet
catchonyet catchonyet
  • 02-08-2019

Answer:

she will have spent 21 hours on the phone

Step-by-step explanation:

6 hours in 2 days

6 divided by 2

3 hours a day

7 days a week

3 multiplied by 7 = 21

Answer Link
jkdkskskdkdks jkdkskskdkdks
  • 02-08-2019

Answer:

Step-by-step explanation:

21 hours

6 hours in two days

3 hours per day

3 hours X 7 days = 21 hours a week

Answer Link

Otras preguntas

Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
What are the factors of 6x + 24?
Please help with Algebra 1
How much money, in dollars, does one mole of nickels represent?
four yardequal Blank feet
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.