nakeytrag
nakeytrag nakeytrag
  • 02-04-2019
  • English
contestada

WHich passage from "The Convict and the Bishop" is the best example of irony?\

WHich passage from The Convict and the Bishop is the best example of irony class=

Respuesta :

Ct518898 Ct518898
  • 05-04-2019

C. From the looks of fear and distrust, he would have guessed that before long his arrival would be the talk of the whole town. He saw nothing of all this. People with trouble do not look behind.

Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Help pl0x, Algebra 1
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
Solve the equation -10 + 3x + 5x = -56 ? ??
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please answer theses division problems!! 9 divided by 3/7
a antonym for biosphere
when Jefferson took office he did what