christophersalas7411 christophersalas7411
  • 01-11-2018
  • Geography
contestada

What kind of plate movement is shown in this figure

What kind of plate movement is shown in this figure class=

Respuesta :

siamese512
siamese512 siamese512
  • 01-11-2018

A) subduction

hope it helps

Answer Link
blhlje blhlje
  • 01-11-2018

convergent, Because the oceanic plate is going under the continental plate



Answer Link

Otras preguntas

Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
In which system of government would states function independently of each other?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Why was wilson not able to finish his speaking tour
What was religion like in Shang China?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what