sophia4043
sophia4043 sophia4043
  • 05-09-2018
  • Mathematics
contestada

Anyone know the answer for #17?

Anyone know the answer for 17 class=

Respuesta :

carly3569
carly3569 carly3569
  • 05-09-2018
1/2 is the answer when you enter it on a calculator.
Answer Link

Otras preguntas

4.2meters= how many centimeter
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
How many times does four go into 153 ? What Is the remainder ?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how do you know 8 thousandths is less than 1 hundredths