duncanje3677 duncanje3677
  • 02-06-2018
  • Mathematics
contestada

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

Respuesta :

Luv2Teach
Luv2Teach Luv2Teach
  • 02-06-2018
This works out beautifully.  You COULD use long division here, but since your numerator is a quadratic, your first instinct should be to try and factor it.  If you factor it, it works out to be (x - 3)(x + 2).  Now it just so happens that when you do that, the (x - 3) in the numerator will cancel with the (x - 3) in the denominator leaving you with one sad and lonely (x + 2) as your answer.
Answer Link

Otras preguntas

How much wood can a wood chuck wood? For real
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
giving brainliest!!!!!!
What is the measure of Angle
hiii, What is a common factor of both terms in 22m - 33?
. Coach Bryant schedules soccer practice from 4:00 PM to 5:15 PM. His team spends 10 minutes stretching and ½ hour passing the ball. The rest of the time is spe
Can anyone Help me pleasee ?
Simplify 12a − (4b + 4a) − b. A. 16a − 3b B. 8a − 3b C. 8a − 5b D. 16a − 5b
Brianna’s pet lizard measures 15 centimeters long. Her goldfish measures 127 millimeters long. How many centimeters longer is Brianna’s lizard than her goldfish
WILL MARK BRAINLIEST!! Write two paragraphs evaluating how the two weaknesses of overuse of credit and buying on margin caused the stock market crash to weaken